some like it hot - others like more protein!
This success story was provided by Felix List (graduate student at Prof. R. Sterner’s Lab; Lehrstuhl Biochemie II, Prof. Sterner; Institute of Biophysics and Physical Biochemistry; University of Regensburg)
1:Expression profile and codon quality of wt sequence
2:Expression profile and codon quality of optimized sequence
3:Protein Standard
(Expression strain: BL21 (DE3) Rosetta2, pET24a)
Background:
Sulfolobus solfataricus, a hyperthermophilic archaeon of the genus Sulfolobus, is found often in accompany of volcanic activity. Temperatures around 80°C, pH 3 and sulphur present are key data of its natural environment. Proteins from thermophilic organisms often have several advantages compared to homologous proteins from mesophilic organisms:
- biophysical studies (KM values, substrate turnover) can be performed within a broader temperature range
- improved temperature stability and often increased stability against proteolytic degradation simplifies overall handling within the lab
- crystallisation for obtaining the protein structure sometimes is easier using thermostable proteins
- thermostable proteins are often more tolerant against multiple mutations compared to their mesophilic counter parts.
Despite their advantages, proteins from thermophilic organisms can be difficult to express in mesophilic hosts, for example Escherichia coli. It can be argued that the large phylogenetic distance between Sulfolobus solfataricus and Escherichia coli is a measure for the difference in codon usage. Analyzing the codon usage with free software (e.g. http://gcua.schoedl.de/) reveals that this is true for the anthranilate synthase subunit II from Sulfolobus solfataricus.
Anthranilate synthase belongs to the familiy of Glutaminamidotransferases. Enzymes within this familiy allow living organisms to incorporate nitrogen into a diversity of metabolic intermediates. The incorporated nitrogen is made available as ammonia from the glutaminase subunit by hydrolysing glutamine. (The Amidotransferases, Zalkin H., Adv Enzymol Relat Areas Mol Biol. 1993;66:203-309). Extensive characterization as well as functional and mutational studies with Sulfolobus solfataricus anthranilate synthase subunit II are strongly hindered by very little to virtually no expression in Escherichia coli under standard conditions. Therefore the Sulfolobus solfataricus anthranilate synthase subunit II gene was optimized for codon usage and GC-content using Mr. Gene’s online tool.
>wt Sequence
ATGGATCTGACCTTGATAATAGACAACTACGATAGTTTTGTTTACAATATAGCCCAAATAG…
>optimized sequence
ATGGATCTGACGCTGATTATCGACAACTATGACAGCTTCGTGTATAACATTGCCCAAATCG…
Felix’s contact data and sequences will be provided upon request.
If you enjoyed this post, please consider to leave a comment or subscribe to the feed and get future articles delivered to your feed reader.









speaking of volcanic activity … http://blog.wired.com/wiredscience/2008/05/unbelievable-pi.html